circad | circRNAs associated with diseases

hsa_circ_0030045
Gene	SLC25A15	Organism	Human
Genome Locus	chr13:41367293-41373451:+	Build	hg19
Disease	Tuberculosis	ICD-10	Respiratory tuberculosis, bacteriologically and histologically confirmed (A15-A19)
DBLink	Link to database	PMID	29057952
Experimental Method
Sample Type	Peripheral blood samples	Comparison	96 patients with active pulmonary TB and 85 healthy controls
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TCCTCTTCATGTGCTACGGC Reverse TTGTGGAAGGCAGCTCTCTG	Statistics	Fold Change : Upregulated, 3.6256505 pvalue : p=0.010558813
Citation
Huang, Z, Su, R, Deng, Z, Xu, J, Peng, Y, Luo, Q, Li, J (2017). Identification of differentially expressed circular RNAs in human monocyte derived macrophages response to Mycobacterium tuberculosis infection. Sci Rep, 7, 1:13673.